(note: there is a video that accompanies this post at the bottom)

A Nobel Prize for a stinking Label maker? Last year’s Nobel Prize in Medicine was awarded for the discovery of the enzyme called telomerase, which nearly all plants and animals use to manufacture longer protective ends, call telomeres.

Without telomerase, you would die of old age at about 12 years old.

So what is telomerase?  Remember having to label your gym locker or maybe your lunchbox with one of these?

These Dymo labelers were pretty cool and they punched out letters by pressing hard, then advancing to the next slot. Telomerase, shown here, is the same type of device but it only has four letters: A for Adenine, T for Thymine, G for guanine and C for cytosine.

The telomere is the repeating message that loops back to cap and protect the ends of the chromosomes. Without them, the cell’s many repair mechanisms would treat the ends like damaged DNA and cause a lot of problems by trying to repair them.

Note that the Telomere overhangs about 200 base pairs on the “sense” strand, which loops back to keep the end from dangling.  It is called 5′ (“five prime”) to 3′ (“three prime”) because that is the direction DNA is read and assembled. It can’t be done in reverse. It is called the Leading strand because at the replication fork, it is made with ease, whereas the 3′ to 5′ strand lags (hence the name of Lagging strand) and limits the speed because of the piecemeal process described here.

The 5′ to 3′ half of the double helix is called the “sense” strand because it contains the genetic coding, which plays like music (in contrast to the 3′ to 5′ matching stand which, if it could be read, would be unintelligible, like Stairway to Heaven played in reverse.)

So just what is the message of the telomeric DNA?  Since it doesn’t encode any of the music (i.e. genes,) it just repeats like The Beatles’ “number nine? number nine? number nine?” over and over but in doing so, is serving the same critical function as the leader on a blank tape.

For humans, the message is “TTAGGG,” over and over again, and that song remains the same for all animals with a backbone. For other critters, like yeast, the repeating message is “GGTGTACGGATGTCTAACTTCTT” (23 base pairs) over and over again. For insects, it’s only 5 base pairs: “TTAGG,” and for most plants, its 7 base pairs (“TTTAGGG”). But almost all eukaryotes (animals whose cells have nuclei) use telomerase to lengthen telomeres, and all eukaryotes need some version of telomere repeats to protect the tips of their chromosomes.

If you were copying taped music but could only press the recording button on the duplicate after pressing the play button on the original, you would have a perfect model for the telomere theory of aging. Every recording is a bit shorter on the duplicate until inevitably you would be losing music. And when the music’s over…turn out the lights for that cell.

————————————————

For extra credit, read on:

Bacteria don’t need telomeres because their DNA is circular so there aren’t any  5′ nor 3′  ends although there is still a sense and antisense distinction. Circular DNA is easily copied, as shown here:

——————–

But bacteria are all single-celled and although they don’t know the difference, you just can’t do very interesting things without cell specialization and cooperation.

Bacteria are all the same so it’s ‘every man for himself.’ That’s because they have the same DNA and the same programming. The only nice thing about being a bacteria? They don’t have to copy, maintain, and repair a huge DNA library. At some point in evolution of life on this planet, cells ‘invented’ nuclei, where genetic information could be relatively sheltered, and the DNA became much longer and organized in a linear fashion, as double helices wrapped around spools and packed together tightly except in areas of active gene usage. Having huge libraries allows for cell specialization (differentiation) and cooperation (by contact, electricity, chemical signals, division of labor, and formation of specialized organs) and that makes it possible to make every creature, from the aardvark to the zebra.

————————

Click here for a video in which Dr. Park explains more: